Page 74 - CB1.3 Genetic Varation sciPAD

PHOTOCOPYING PROHIBITED
© Silverback Academic Media
74 CB 1.3 GENETIC VARIATION
USING KNOWLEDGE OF GENETICS
DNA Barcoding
There are genetic markers that are common to all living things; however the sequence of bases
within these markers are unique to each species. DNA barcoding is a method used to identify
species based on the nucleotide (base) sequence of the genetic marker. Just as the barcode
scanner at a grocery store can identify lettuce, milk or steak, the DNA barcode sequence can be
used to identify different species. Members of the same species have the same base sequence,
meaning they have the same DNA barcode. Species that are closely related (e.g. great spotted
kiwi and the little spotted kiwi), will have similar, but not the exact same DNA barcode - a few
bases in the DNA barcode sequence will be different. Species that are not closely related will
have many differences in the base sequence of the DNA barcode.
1. Define a ‘genetic marker’. 

2. Describe a ‘DNA barcode’. 


3. State what can be determined if DNA barcodes from two different individuals are:
(a) the same. 
(b) very similar. 
(c) very different. 
4. Two DNA barcodes from two individuals are shown below.
ATGGCCCCCAACATTCGAAAATCGCACCCCCTGCTCAAAATTATCAAC
ATGGGCCGCAACATTCGCAACTCGCACCGCCTGCTCCAAATTATCATC
Identify the number of differences between the two animals and use this to calculate the
percentage difference between them. 

5. The Barcode of Life Data Systems (‘BOLD’) was launched in 2005 as a database of all
known DNA barcodes. When an animal is sampled, its DNA barcode can be compared
to known species. Suggest a possible reason why a newly sampled animal wouldn’t match
any of the barcodes in the BOLD database.


Identifying Species and Relatedness with DNA Barcodes
The barcode sequence is 48 bases long. The two bird species
differ at 5 sites, so they are 5/48 or 10.5% different or 89.5% similar.
ATGGCCCCCAACATTCGAAAATCGCACCCCCTGCTCAAAATTATCAAC
ATGGCCCCCAACATTCGAAAATCGCACCCCCTGCTCAAAATTATCAAC
ATGGCCCCTAACATCCGAAAATCCCACCCTCTACTCAAAATCATCAAC
Although these two birds might look like different species, their DNA
barcodes are exactly the same. This means they are the same species.
The DNA barcodes of these two birds show a number of differences.
Unchecked Sample Pages
For Review Purposes Only - Photocopying Prohibited
www.scipad.co.nz